Filters

Selected Range:

Search Government Tenders & JV Opportunities

Use smart filters to find live tenders across India. Explore JV opportunities, subcontracting, and complete tender assistance with TenderKings.

TKID: 19941546
Indian Council Of Agricultural Research

14 Days Left
Khorda, Odisha
Last Date: 04 Jul 2026

Supply Of Fish Feed (v3) Conforming To Is 16150

Estimate: Refer to Document View
TKID: 19941538
Indian Council Of Agricultural Research

14 Days Left
Khorda, Odisha
Last Date: 04 Jul 2026

Supply Of Fish Feed (v3) Conforming To Is 16150

Estimate: Refer to Document View
TKID: 19941532
Indian Council Of Agricultural Research

14 Days Left
Khorda, Odisha
Last Date: 04 Jul 2026

Supply Of Fish Feed (v3) Conforming To Is 16150

Estimate: Refer to Document View
TKID: 19941437
Indian Council Of Agricultural Research

16 Days Left
Bharatpur, Rajasthan
Last Date: 06 Jul 2026

Supply Of Maxiamp 0.2 Ml Pcr Strips Flat Cap,microcentrifuge Tubes 2 Ml,maxipense Low Retention Tips 1 200 Ul 1000 Tips,maxipense Low Retntion Tips 100 1000 Ul 500 Tips,maxipense Low Retention Tips 0.5 10 Ul 1000 Tips,combi Lock Rack,nitrile Gloves Powder Free,kimwipes Disposable...

Estimate: Refer to Document View
TKID: 19941420
Indian Council Of Agricultural Research

16 Days Left
Bharatpur, Rajasthan
Last Date: 06 Jul 2026

Supply Of Phenol Chloroform Isoamyl Alcohol Ph 8.0 For Molecular Biology 500 Ml,6x Dna Loading Dye 5 Ml,isopropanol Ipa Gc Hs 99 9 Percentage,n Hesane Extrapure Annual Repair 99 Percentage 2500 Ml,methanol Gc Hs 99 9 Percenrage

Estimate: Refer to Document View
TKID: 19941416
Indian Council Of Agricultural Research

16 Days Left
Bharatpur, Rajasthan
Last Date: 06 Jul 2026

Supply Of Dream Taq Dna Polymerase 5u 500 U,taq Dna Polymerase 5u 500u,dntp Mix 2 Mm Each 1 Ml,na,na1

Estimate: Refer to Document View
TKID: 19941399
Indian Council Of Agricultural Research

16 Days Left
Bharatpur, Rajasthan
Last Date: 06 Jul 2026

Supply Of Cgg Aag Act Tgc Tct Tct Ta,gtt Att Tgg Tgc Ata Taa Tac Ata,tca Gat Ccc Aga Aga Ctt Gtt Aat,atg Tat Ata Tgt Gta Tga Atg Tag Tac Tcg,gat Ctg Gat Gtt Cat Aag G,gaggtggaagagtacggttgtg,cctcacaatttcagtcaacatcgt,gccacctcctagatgtggtcata,gtccatccaggtgtttcacg,ggcatagtattccctagaag...

Estimate: Refer to Document View
TKID: 19941396
Indian Council Of Agricultural Research

16 Days Left
Jhansi, Uttar Pradesh
Last Date: 06 Jul 2026

Supply Of Potassium Dichromate,sulphuric Acid,ferrous Ammonium Sulphate,diphenyl Amine Indicator,orthophosphoric Acid,potassium Permanganate,sodium Hydroxide,boric Acid,potassium Hydrogen Phthalate,ammonium Fluoride,hcl Hydrochloric Acid,stannous Chloride,sodium Bicarbonate,activ...

Estimate: Refer to Document View
TKID: 19941355
Indian Council Of Agricultural Research

16 Days Left
Bangalore, Karnataka
Last Date: 06 Jul 2026

Supply Of Gcms And Delivery Tube,nil1,nil2,nil3,nil4

Estimate: ₹80.00 Lacs View
TKID: 19941241
Indian Council Of Agricultural Research

16 Days Left
Hyderabad-T, Telangana
Last Date: 06 Jul 2026

Supply Of Repairwork 1,repairwork 1,repairwork 1,repairwork 1,repairwork 1,repairwork 2,repairwork 2,repairwork 2,repairwork 2,repairwork 2,repairwork 3,repairwork 3,repairwork 3,repairwork 3,repairwork 3,repairwork 4,repairwork 4,repairwork 4,repairwork 4,repairwork 4,repairwork...

Estimate: Refer to Document View

Government Tender & JV Services by TenderKings

TenderKings helps businesses search and apply for government tenders across India. We specialize in Joint Venture (JV) support, sub-contractor onboarding, and vendor registration for sectors like civil works, IT, road construction, and infrastructure development. Use our smart filters to explore live tenders and find the right JV opportunities tailored to your business needs.