Search Government Tenders & JV Opportunities

Supply Of Interactive Panels With Cpu

Supply Of 10 Ref,10 Ref,10 Ref,10 Ref,10 Ref,10 Ref,10 Ref,10 Ref,200 Ref,200 Ref,200 Ref,200 Ref,200 Ref,200 Ref,200 Ref,200 Ref,1000 Ref,1000 Ref,1000 Ref,1000 Ref,1000 Ref,1000 Ref,1000 Ref,1000 Ref,spinwin Cliklok Microcentrifuge Tube,spinwin Cliklok Microcentrifuge Tube,spin...

Supply Of High Density Polyethylene (hdpe) Woven Bed Vermiculture - Vermibed Isi Marked To Is 15907

Supply Of Fish Feed (v3) Conforming To Is 16150

Supply Of Fish Feed (v3) Conforming To Is 16150

Supply Of Fish Feed (v3) Conforming To Is 16150

Supply Of Maxiamp 0.2 Ml Pcr Strips Flat Cap,microcentrifuge Tubes 2 Ml,maxipense Low Retention Tips 1 200 Ul 1000 Tips,maxipense Low Retntion Tips 100 1000 Ul 500 Tips,maxipense Low Retention Tips 0.5 10 Ul 1000 Tips,combi Lock Rack,nitrile Gloves Powder Free,kimwipes Disposable...

Supply Of Phenol Chloroform Isoamyl Alcohol Ph 8.0 For Molecular Biology 500 Ml,6x Dna Loading Dye 5 Ml,isopropanol Ipa Gc Hs 99 9 Percentage,n Hesane Extrapure Annual Repair 99 Percentage 2500 Ml,methanol Gc Hs 99 9 Percenrage

Supply Of Dream Taq Dna Polymerase 5u 500 U,taq Dna Polymerase 5u 500u,dntp Mix 2 Mm Each 1 Ml,na,na1

Supply Of Cgg Aag Act Tgc Tct Tct Ta,gtt Att Tgg Tgc Ata Taa Tac Ata,tca Gat Ccc Aga Aga Ctt Gtt Aat,atg Tat Ata Tgt Gta Tga Atg Tag Tac Tcg,gat Ctg Gat Gtt Cat Aag G,gaggtggaagagtacggttgtg,cctcacaatttcagtcaacatcgt,gccacctcctagatgtggtcata,gtccatccaggtgtttcacg,ggcatagtattccctagaag...